Glyma20g25000 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g25000

Feature Type:	gene_model
Chromosome:	Gm20
Start:	34688253
stop:	34690758
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g25000

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G68480	AT	Annotation by Michelle Graham. TAIR10: C2H2 and C2HC zinc fingers superfamily protein \| chr1:25684543-25685932 REVERSE LENGTH=253	SoyBase	E_val: 4.00E-48	ISS
GO:0009908	GO-bp	Annotation by Michelle Graham. GO Biological Process: flower development	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0010093	GO-bp	Annotation by Michelle Graham. GO Biological Process: specification of floral organ identity	SoyBase	N/A	ISS
GO:0010158	GO-bp	Annotation by Michelle Graham. GO Biological Process: abaxial cell fate specification	SoyBase	N/A	ISS
GO:0048440	GO-bp	Annotation by Michelle Graham. GO Biological Process: carpel development	SoyBase	N/A	ISS
GO:0048443	GO-bp	Annotation by Michelle Graham. GO Biological Process: stamen development	SoyBase	N/A	ISS
GO:0048451	GO-bp	Annotation by Michelle Graham. GO Biological Process: petal formation	SoyBase	N/A	ISS
GO:0048453	GO-bp	Annotation by Michelle Graham. GO Biological Process: sepal formation	SoyBase	N/A	ISS
GO:0048507	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem development	SoyBase	N/A	ISS
GO:0048653	GO-bp	Annotation by Michelle Graham. GO Biological Process: anther development	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
UniRef100_C6ES39	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Lyrate n=1 Tax=Solanum lycopersicum RepID=C6ES39_SOLLC	SoyBase	E_val: 2.00E-52	ISS
UniRef100_I1NFJ4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1NFJ4_SOYBN	SoyBase	E_val: 2.00E-94	ISS

Proteins Associated with Glyma20g25000

Locus	Gene Symbol	Protein Name
Ln	JAG1	JAGGED gene 1

Expression Patterns of Glyma20g25000

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g25000

Paralog	Evidence	Comments
Glyma10g42020	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g25000 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g116200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g25000

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g25000

Limit To All Plant Sequences

>Glyma20g25000.2   sequence type=CDS   gene model=Glyma20g25000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGACCAGAACGAAACCCCTTAGATCTTAACAATTTGCCCGATGAGTACTCTAGAGATGGCAAACAAGTCCTCGAAGACCATACCTCTTCATCCGGTTGCAGGAAAAAGAAAAGCGGCGGGAAGGATGGAAAAGACGAGTGTGGGAAGGTCTACGAGTGTAGATTTTGTTCCCTCAAGTTCTGCAAGTCTCAGGCTCTTGGGGGACACATGAACCGCCACCGCCAAGAGAGGGAAACGGAGACGCTGAACCAGGCTCGTCAACTGGTCTTTCGTTGTGATCATAACATTGCTGCACAAGGTGCCCCTCACTTAGGATGCTGCCAAACAATAGGAACGGGGGGTTATCATCCCTCAGGAGACCCAACAGTGCCTCTAAGATTCCCAAGATACTTCTCAGGTTCATCCTCAACTCACATGCCACCATCCCCGCCACCGCCGCCGCCACCGCAACGACCATACCTATACCCTTCACCTACGAGGCCAGTGTCATTTGGGTCATCACACTTCCCTCTCCAGCATGCAGTGAACGATTACTATGTGGGCCACGTGATGAGTGGTGGCAGCCACGGACACTATGTTGGAGGAGAGAGCACAAGGAGTTACACGTGCATTGGTGCACCGGTGGGGCAAGGTGGCGGATTCGCTGGTGGTAAGGAGGGGTCTGCAGTGCAGGAGGAAGGGTTGAGTACTTGGGGAAGGGGCTATTCAGGTGCACAGGATCGTTTGGATCCTCCCTCAGCGATCAATCGGTTTCAAGATGGTTTCTAA

Predicted protein sequences of Glyma20g25000

Limit To All Plant Sequences

>Glyma20g25000.2   sequence type=predicted peptide   gene model=Glyma20g25000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRPERNPLDLNNLPDEYSRDGKQVLEDHTSSSGCRKKKSGGKDGKDECGKVYECRFCSLKFCKSQALGGHMNRHRQERETETLNQARQLVFRCDHNIAAQGAPHLGCCQTIGTGGYHPSGDPTVPLRFPRYFSGSSSTHMPPSPPPPPPPQRPYLYPSPTRPVSFGSSHFPLQHAVNDYYVGHVMSGGSHGHYVGGESTRSYTCIGAPVGQGGGFAGGKEGSAVQEEGLSTWGRGYSGAQDRLDPPSAINRFQDGF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain